....
 
 
 
sequenziamento  e genotyping
 

Novità

Novità

Offerte di LAvoro

FacebookTwitterLinkedin

 
 
 
Oligo per sequenziare e universali
 
Oligo per Sequenziare

Ecco un elenco di regole per disegnare un buon oligo:

  • Lunghezza di circa 18-25 basi
  • T di annealing maggiori o uguali a 50°C
  • Percentuale di C e G tra il 40-70%
  • 3' stabile (G o C).
  • Evitate ripetizioni, stretch, palindroni e hairpin

    Nel caso di OLIGO DEGENERATI consigliamo di aumentare la quantita' di picomoli in base al numero delle degenerazioni presenti.
 
Oligo Universali
Vengono forniti gratuiti, pero’ e’ MOLTO IMPORTANTE che verificate che la sequenza sia corrispondente
esattamente a quella del vostro plasmide.
I
II
III
IV
V
VI
VII
VIII
IX
X
XI
XII
XIII
XIV
M13
M13 rev
T3
T7
SP6
SP6PpcDNA3
KS
SK
PCR3.1
BGH REVERSE
T7term NOVAGEN
5' pGEX
3' pGEX
CMV For
5' TGT AAA ACG ACG GCC AGT 3'
5' CAG GAA ACA GCT ATG ACC 3'
5' ATT AAC CCT CAC TAA AGG GA 3'
5' TAA TAC GAC TCA CTA TAG GG 3'
5' AGG TGA CAC TAT AGA ATA CTC 3'
5' AGG TGA CAC TAT AGA ATA GGG 3'
5' TCG AGG TCG ACG GTA TC 3'
5' CGC TCT AGA ACT AGT GGA TC 3'
5' TAG AAG GCA CAG TCG AGG 3'
5' TAG AAG GCA CAG TCG AGG 3'
5' CTAGTTATTGCTCAGCGG 3'
5' GGGCTGGCAAGCCACGTTTGGTG 3'
5' GCATGTGTCAGAGGTTTTCACCG 3'
5’ CGC AAA TGG GCG GTA GGC GTG 3’
 
Altri Oligo
Se vi dovessero essere utili anche questi sono gratuiti.
I
II
III
IV
V
EGFP-C
POLI T N
POLI T M
POLI T R
POLI T S
5' ATG GTC CTG CTG GAG TTC GTG 3'
5' TTT TTT TTT TTT TTT TTT TTT N(A/C/T/G) 3'
5' TTT TTT TTT TTT TTT TTM(A/C) 3'
5' TTT TTT TTT TTT TTT TTR(A/G) 3'
5' TTT TTT TTT TTT TTT TTS(G/C) 3'
 
 
 
 
© 2006 BIO-FAB RESEARCH - TUTTI I DIRITTI RISERVATI
Sede legale: Bio-Fab Research srl – Via Mario Beltrami, 5 – 00135 ROMA
P.I./C.F./CCIAA n. 08736731004 - REA n. 1114841 - Cap. soc. i.v. 10.000,00